pbpX [2018-02-16 12:32:25]

penicillin-binding protein X

Locus: BSU16950

Isoelectric point: 9.71

Molecular weight: 43.70 kDa

Protein length: 391 aa

Gene length: 1173 bp

Function: endopeptidase

Product: penicillin-binding protein X

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall synthesis → Penicillin-binding proteins
• Lifestyles → Coping with stress → Cell envelope stress proteins (controlled by SigM, V, W, X, Y)
• Groups of genes → Secreted proteins
• Groups of genes → Membrane proteins

Gene

Coordinates: 1,765,859 → 1,767,034

Phenotypes of a mutant

• increased sensitivity to lysozyme PubMed
• inactivation of pbpX strongly restores beta-lactam resistance in a sigM mutant PubMed

The protein

Localization

• extracellular (signal peptide) PubMed
• localizes during sporulation to both asymmetric septa and the prespore PubMed

Expression and Regulation

Operons

• Genes: pbpX
  Description: PubMed

  Sigma factors

  • SigM: sigma factor, PubMed, in SigM regulon
  • SigX: sigma factor, PubMed, in SigX regulon
  • SigV: sigma factor, PubMed, in SigV regulon

  Regulation

  • expression is reduced in a SigV mutant PubMed

Biological materials

Mutant

• MGNA-B074 (pbpX::erm), available at the NBRP B. subtilis, Japan
• BKE16950 (ΔpbpX::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCATTTTTTCCTCCCAA, downstream forward: _UP4_TGATTGGCGATCTTCTTTTG
• BKK16950 (ΔpbpX::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCATTTTTTCCTCCCAA, downstream forward: _UP4_TGATTGGCGATCTTCTTTTG

GFP fusion

• 3107 trpC2 pbpX::pSG5047 (cat P_xyl-gfpa-pbpX1-426) PubMed, available in Dirk Jan Scheffers' lab and in the BGSC

References

Loading